636568 trans blot turbo rta midi  (TaKaRa)

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation induced by SLC31A11 knockdown triggers the upregulation of SLC7A11. ( A ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown AsPC-1 cells. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( B ) Total Fe level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( C ) Volcano plot of gene expression (the SLC31A1 knockdown [shRNA#2] versus the control; log2(fold change) ≥1; p < 0.05 between SLC31A1 knockdown and NC AsPC-1 cells. ( D ) GO analysis of differentially expressed genes between SLC31A1 knockdown (shRNA#2) and NC AsPC-1 cells. ( E-G ) Western blot analysis of the indicated protein levels in the NC and SLC31A1 knockdown AsPC-1 (E), MiaPaCa-2 (F), and CFPAC-1 (G) cells. ( H and I ) GPX4 (H) or FSP-1 activity (I) was tested in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( J ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( K ) qPCR analysis of SLC31A1 and SLC7A11 gene expression in NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) GSH level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) Cystine uptake level in the NC and SLC31A1 knockdown AsPC-1, MiaPaCa-2, and CFPAC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

Techniques: Knockdown, Imaging, Gene Expression, shRNA, Control, Western Blot, Activity Assay

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation induced by SLC31A1 knockdown attenuates ferroptosis. ( A ) Cell viability of AsPC-1 cells treated with different doses of RSL3, ML162, ML210, or erastin in NC and SLC31A1 knockdown AsPC-1 cells. ( B ) Cell viability of AsPC-1 cells treated with different doses of CDDP, staurosporine, paclitaxel, bortezomib, JTC-801, or elesclomol-Cu in NC and SLC31A1 knockdown AsPC-1 cells. ( C-E ) Propidium iodide (PI) staining of NC and SLC31A1 knockdown AsPC-1 (C), MiaPaCa-2 (D), and CFPAC-1 (E) cells treated with RSL3 at the indicated concentrations in the presence or absence of ferroptosis inhibitors (ferrostatin-1/Fer-1, 5 μM or desferrioxamine/DFO, 20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( F ) Lipid peroxidation of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. (G) Transmission electron microscopy of NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 (2.5 μM). Scale bar: 2 μm or 500 nm. ( H ) Confocal imaging of Cu-probe and Mito-tracker in the NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. Hoechst (blue) is used as a nuclear counterstain. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 2 μm. ( I ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1. ( J ) Cell viability of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with different doses of RSL3 or erastin. ( K ) PI staining of NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or a vector encoding SLC31A1, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( L ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid. ( M ) PI staining of SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or SLC31A1 WT or SLC31A1 M154A plasmid, followed by treatment with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

Techniques: Knockdown, Staining, Transmission Assay, Electron Microscopy, Imaging, shRNA, Transfection, Plasmid Preparation, Western Blot

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC), SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells treated with or without TM (50 μM) for 24 h. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Propidium iodide (PI) staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). PI staining of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( E ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( F ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( G ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of BSO (500 μM) with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( H ) PI staining images of the indicated AsPC-1 cells treated with or without BSO (500 μM) plus TM sulfate (50 μM) with RSL3 at the indicated concentrations with or without Fer-1 (5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test.

Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

Techniques: Knockdown, shRNA, Transfection, Western Blot, Staining

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: SLC7A11 is essential for copper deprivation-mediated ferroptosis resistance. ( A ) Vector or flag-SLC7A11 overexpressed AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11). Western blot analysis of lysates from the indicated AsPC-1 cells. ( B ) AsPC-1 cells were transfected with a vector or a plasmid encoding Flag-SLC7A11 and then treated with TM (50 μM) for 24h. Western blot analysis of lysates from the indicated AsPC-1 cells. ( C ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining of indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( D ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or SLC7A11 siRNA (siSLC7A11) with or without transfection with a blank vector or a vector encoding SLC7A11. PI staining images of indicated AsPC-1 cells treated with RSL3 (0.25 μM) or TM (50 μM) in the presence or absence of Fer-1 (2.5 μM) or DFO (20 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

Techniques: Plasmid Preparation, Transfection, Western Blot, Knockdown, shRNA, Staining

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation upregulates SLC7A11 and activates AMPK-NRF2 axis. ( A ) Volcano plot of NRF2 target genes (shSLC31A1 VS shNC) generated using the data from C. ( B , C ) ChIP analyses of NRF2 binding in the SLC7A11 promoter in NRF2 knockdown AsPC-1 cells (B) or SLC31A1 knockdown AsPC-1 cells (C). ( D-G ) The oxygen consumption rate (OCR) in NC and SLC31A1 knockdown AsPC-1 cells by Seahorse assay (n = 8/group). Quantification of basal respiration (E) and ATP-linked respiration (F), the uncoupler FCCP (maximal) or the electron transport inhibitor antimycin A-baseline (G) in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 8. Statistical significance was determined using a one-way ANOVA test. ( H ) COX activity level in the NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( I–K ) ATP level in the NC and SLC31A1 knockdown AsPC-1(I), MiaPaCa-2 (J), and CFPAC-1 (K) cells. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( L ) ATP level in the AsPC-1 cells treated with TM (50 μM) or TEPA (1 mM) for 24 h. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test. ( M ) AMP/ATP ratio detected by HPLC in NC and SLC31A1 knockdown AsPC-1 cells. Mean ± SD, n = 3. Statistical significance was determined using an unpaired T test. ( N ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells. ( O ) Western blot analysis of lysates from AsPC-1 cells treated with TM at the indicated concentrations for 24 h. ( P ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or vector encoding SLC31A1. ( Q ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with blank vector or of SLC31A1 WT- or SLC31A1 M154A.

Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

Techniques: Generated, Binding Assay, Knockdown, Activity Assay, Western Blot, shRNA, Transfection, Plasmid Preparation

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation upregulates SLC7A11 through AMPK-NRF2 axis. ( A ) Western blot analysis of lysates from NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). ( B ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNFE2L2#2). * indicates a non-specific band. ( C ) SLC7A11 mRNA level in NC and SLC31A1 knockdown AsPC-1 cells transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2#2). ( D ) Western blot analysis of lysates from AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( E ) SLC7A11 mRNA level in AsPC-1 cells that were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2) and treated with TM (50 μM) or without TM for 24 h. ( F ) Western blot analysis of lysates from NC and SLC31A1 knockdown AsPC-1 cells treated with or without ML385 (5 μM) for 24 h. ( G ) Western blot analysis of lysates from SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. ( H ) SLC7A11 mRNA level in SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid. Mean ± SD, n = 3. Statistical significance was determined using a one-way ANOVA test.

Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

Techniques: Western Blot, Knockdown, shRNA, Transfection, Plasmid Preparation

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation inhibits ferroptosis by the activation of AMPK. ( A ) NC and SLC31A1 knockdown (shRNA#2) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). Propidium iodide (PI) staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( B ) AsPC-1 cells were transfected with non-targeting scrambled siRNA (siNC) or AMPK siRNA (siAMPKα1/2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. ( C ) PI staining of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of Compound C (10 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

Techniques: Activation Assay, Knockdown, shRNA, Transfection, Staining

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: Copper deprivation inhibits ferroptosis by the activation of AMPK-NRF2-SLC7A11 pathway. ( A ) NC and SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( B ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). PI staining images of the indicated AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of TM (50 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( C ) SLC31A1 knockdown AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA#2 (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) for 2 h. ( D ) AsPC-1 cells were transfected with non-targeting scrambled shRNA (shNC) or NRF2 shRNA (shNRF2). Lipid peroxidation of the indicated AsPC-1 cells treated with RSL3 (0.25 μM) in the presence or absence of TM (50 μM) for 2 h. ( E ) PI staining images of the NC and SLC31A1 knockdown AsPC-1 cells treated with RSL3 at the indicated concentrations in the presence or absence of ML385 (5 μM) for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm. ( F ) PI staining of SLC31A1 knockdown (shRNA#2) and NRF2 knockdown (shRNA#2) AsPC-1 cells transfected with a blank vector or NRF2 WT or NRF2 S558A plasmid, followed by treatment with RSL3 at the indicated concentrations for 6 h. Quantification of PI-positive cells was shown. Mean ± SD, n = 3. Statistical significance was determined using a two-way ANOVA test. Scale bar: 50 μm.

Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

Techniques: Activation Assay, Knockdown, Transfection, shRNA, Staining, Plasmid Preparation

Journal: Redox Biology

Article Title: Copper deprivation reprograms antioxidant defense to suppress ferroptosis via SLC7A11

doi: 10.1016/j.redox.2026.104130

Figure Lengend Snippet: SLC31A1 knockdown inhibits ferroptosis in vivo . ( A-D ) Subcutaneous growth of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice (n = 8) treated with RSL3 (5 mg/kg, i.p., once every other day). ( A ) Tumor growth curves of NC and SLC31A1 knockdown AsPC-1 xenografts in nude mice treated with the indicated agents. Representative images of tumors and tumor weight were shown ( B ). Data are presented as mean ± SD, n = 8 mice per group; Statistical significance was determined using a two-way ANOVA test. ( C ) Total copper content in the tumor sections. Statistical significance was determined using a two-way ANOVA test. ( D and E ) Immunohistochemical staining and relative staining intensity of the indicated proteins in the tumor sections. CC3, cleaved caspase 3. Scale bar: 20 μm. Statistical significance was determined using a two-way ANOVA test.

Article Snippet: Human SLC31A1 RNA primers: F: CCAGGACCAAATGGAACCATCC R: ACCACCTGGATGATGTGCAGCA , Sangon Biotech , This paper.

Techniques: Knockdown, In Vivo, Immunohistochemical staining, Staining

Journal: International Journal of Oncology

Article Title: Therapeutic implications of targeting cancer testis antigen MAGEA1 in cervical cancer

doi: 10.3892/ijo.2026.5870

Figure Lengend Snippet: Effects of MAGEA1 knockdown on mRNA/protein expression and cellular functions including proliferation, viability, migration, and invasion. (A) Western blotting detected MAGEA1 expression in SK-OV-3 (ovarian cancer), Panc1 (pancreatic cancer), HupT3 (pancreatic cancer), HeLa (cervical cancer), and T24 (urinary bladder carcinoma). GAPDH was used as a loading control. HeLa was transfected with shMAGEA1 #1 and #2 and shNC was established as a control. (B) Reverse transcription-quantitative PCR and (C) western blot analysis were used to estimate the efficiency of knockdown. (D) Cell viability was determined by MTT assay after 24 h of cell seeding. (E) A significant decrease in cell proliferation was observed in MAGEA1 knockdown compared with control. The number of proliferated cells is presented as a percentage of the control. (F) Representative images from wound scratch at different time points (magnification, ×40). (G) Percentages of wound closure at 24 and 72 h are shown as a bar graph. The scratched area and lines were quantified by ImageJ software with the MRI tool. (H) Cell migration and invasion were confirmed by Transwell migration and invasion assays. Representative images of cells are illustrated below. Scale bar, 500 μ m. (I) Quantification of migrated and invaded cells in distinct groups. The number of migrated and invaded cells is presented as a percentage of the control. Error bars represent the mean ± SEM. * P<0.05, ** P<0.01, *** P<0.005. MAGEA1, MAGE family member A1; sh, short hairpin; NC, negative control.

Article Snippet: Lentiviral transduction was performed using MAGEA1 short hairpin RNAs (shRNAs) lentiviral plasmids (#1 and #2, cat. no. 4100; OriGene Technologies, Inc.) in pGFP-C-shLenti vector.

Techniques: Knockdown, Expressing, Migration, Western Blot, Control, Transfection, Reverse Transcription, Real-time Polymerase Chain Reaction, MTT Assay, Software, Negative Control

Journal: International Journal of Oncology

Article Title: Therapeutic implications of targeting cancer testis antigen MAGEA1 in cervical cancer

doi: 10.3892/ijo.2026.5870

Figure Lengend Snippet: Effect of MAGEA1 knockdown on colony formation, chemosensitivity, and cell cycle progression. (A) A Schematic diagram of 3D experimental design. (B) Fluorescent microscope images of DAPI staining (magnification ×40, ×100). Scale bar, 500 μ m. (C) Quantification of colony formation with 8 or more colonies on GelMA. Cells were treated with (D) 1 μ M of paclitaxel and (E) 20 μ M of cisplatin for 48 h and cell viability was measured by MTT assays. (F) Cells were stained with PI and analyzed using Cytexpert software (v2.4). (G) Representative DNA content histograms showing distributions across G0-G1, S, and G 2 -M phases in each group samples. Error bars represent the mean ± SEM. * P<0.05, ** P<0.01, *** P<0.005. MAGEA1, MAGE family member A1; GelMA, gelatin methacryloyl.

Article Snippet: Lentiviral transduction was performed using MAGEA1 short hairpin RNAs (shRNAs) lentiviral plasmids (#1 and #2, cat. no. 4100; OriGene Technologies, Inc.) in pGFP-C-shLenti vector.

Techniques: Knockdown, Microscopy, Staining, Software

Journal: International Journal of Oncology

Article Title: Therapeutic implications of targeting cancer testis antigen MAGEA1 in cervical cancer

doi: 10.3892/ijo.2026.5870

Figure Lengend Snippet: Comprehensive transcriptomic and functional analysis of MAGEA1 knockdown in HeLa cells. (A) Heatmap representing DEGs between shNC and shMAGEA1-transfected HeLa cells based on RNA sequencing data. (B) ClueGO pathway network analysis showing markedly altered biological processes following MAGEA1 knockdown. (C) Functional enrichment network of upregulated genes (Hela_FDR001_logFC0_UP_GOBP) following MAGEA1 knockdown in HeLa cells. MAGEA1, MAGE family member A1; DEGs, differentially expressed genes; sh, short hairpin; NC, negative control.

Article Snippet: Lentiviral transduction was performed using MAGEA1 short hairpin RNAs (shRNAs) lentiviral plasmids (#1 and #2, cat. no. 4100; OriGene Technologies, Inc.) in pGFP-C-shLenti vector.

Techniques: Functional Assay, Knockdown, Transfection, RNA Sequencing, Negative Control

Journal: International Journal of Oncology

Article Title: Therapeutic implications of targeting cancer testis antigen MAGEA1 in cervical cancer

doi: 10.3892/ijo.2026.5870

Figure Lengend Snippet: Gene expression changes and validation of key DEGs following MAGEA1 knockdown. (A) GSEA plots showing significant enrichment of genes. Pathways markedly enriched in the shMAGEA1 group including apoptosis, G 2 M checkpoint, and DNA repair, indicating enhanced cell death signaling and disrupted cell cycle regulation. (B-D) Heatmap shows expression levels of genes in G 2 /M checkpoint, apoptosis and hypoxia pathways following MAGEA1 knockdown vs. control (shNC) cells. Red indicates upregulated genes; blue indicates downregulated genes. (E and F) Quantitative PCR of selected differentially expressed genes. Error bars represent the mean ± SEM. *** P<0.005. DEGs, differentially expressed genes; MAGEA1, MAGE family member A1; GSEA, gene set enrichment analysis; sh, short hairpin; NC, negative control.

Article Snippet: Lentiviral transduction was performed using MAGEA1 short hairpin RNAs (shRNAs) lentiviral plasmids (#1 and #2, cat. no. 4100; OriGene Technologies, Inc.) in pGFP-C-shLenti vector.

Techniques: Gene Expression, Biomarker Discovery, Knockdown, Expressing, Control, Real-time Polymerase Chain Reaction, Negative Control

Journal: International Journal of Oncology

Article Title: Therapeutic implications of targeting cancer testis antigen MAGEA1 in cervical cancer

doi: 10.3892/ijo.2026.5870

Figure Lengend Snippet: MAGEA1 knockdown suppresses tumorigenicity of cervical cancer cells in vivo . (A) Schematic diagram of the xenograft experiment using BALB/c nude mice injected with HeLa cells transfected with shNC, shMAGEA1 #1, or shMAGEA1 #2. (B) Representative images of excised tumors from each group at day 28 post-injection. (C) Tumor growth curves showing tumor volumes measured twice a week. Mice injected with shMAGEA1 HeLa cells exhibited markedly reduced tumor volumes compared with the control group. (D) Final tumor weights measured at the end of the experiment (day 30). (E) Representative immunohistochemical staining images showing MAGEA1 and Ki-67 expression in tumor tissues from mice injected with HeLa cells transfected with shNC, shMAGEA1 #1, or shMAGEA1 #2. Scale bar, 300 μ m. (F) Comprehensive study of MAGEA1 function and expression in cervical cancer. Error bars represent the mean ± SEM. * P<0.05, *** P<0.005. MAGEA1, MAGE family member A1; sh, short hairpin; NC, negative control.

Article Snippet: Lentiviral transduction was performed using MAGEA1 short hairpin RNAs (shRNAs) lentiviral plasmids (#1 and #2, cat. no. 4100; OriGene Technologies, Inc.) in pGFP-C-shLenti vector.

Techniques: Knockdown, In Vivo, Injection, Transfection, Control, Immunohistochemical staining, Staining, Expressing, Negative Control